Q&A Hero

Q: FGA is one of the STRs that are used to compare DNA between different people. Why is FGA useful for comparing DNA between different people? A) FGA varies in the number of repeats between different people. B) FGA varies in sequence between different people. C) FGA is only present in some peoples' genomes. D) FGA is present in different places in different peoples' genomes.

Q: STR analysis is a DNA profiling technique that makes use of the fact that different people have ________. A) different numbers of repeats of short DNA sequences at certain sites in the genome B) different alleles for many genes in the genome C) different restriction fragments D) different CODIS DNA sequences

Q: Gel electrophoresis separates DNA fragments on the basis of differences in their ________. A) A:C ratio B) length C) G:T ratio D) pH

Q: To make restriction fragments, a DNA sample is treated with ________. A) DNA ligase B) restriction enzymes C) DNA polymerase D) lysozyme

Q: Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________. A) gel electrophoresis B) enzymes C) recombinant DNA D) plasmids

Q: What name is given to a region of DNA that varies from person to person? A) genetic marker B) short tandem repeat C) sticky end D) restriction fragment

Q: You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association? A) You can use the sample to determine the individual's blood type. B) You can use gel electrophoresis to determine the length of the DNA found in the sample. C) You can use PCR to increase the amount of DNA available for STR analysis. D) You can use the sample to check for the presence of the Rhesus factor.

Q: HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA A) 0 times B) 1 time C) 2 times D) 3 times

Q: Of the following, which is the last step in the production of a recombinant DNA plasmid? A) cloning B) using DNA ligase to join DNA fragments C) cutting the gene of interest into fragments D) allowing the reproduction of the bacterium bearing the recombinant plasmid

Q: Which enzyme is used to bind DNA fragments together? A) restriction enzyme B) lysozyme C) DNA ligase D) DNA polymerase

Q: A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ________. A) TAAGC- B) CGGAT- C) GCCTA- D) ATTGC-

Q: "Sticky ends" are ________. A) single-stranded ends of fragments of double-stranded DNA B) regions of double-stranded DNA that can be cut by a restriction enzyme C) portions of DNA used as markers for STR analysis D) regions of DNA amplified in PCR

Q: "Sticky ends" are produced as a result of the action of ________. A) PCR B) DNA ligase C) restriction enzymes D) bacterial plasmids

Q: Restriction enzymes are obtained from ________. A) archaea B) eukaryotes C) viruses D) bacteria

Q: The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________. A) gene cloning B) PCR C) STR analysis D) whole-genome shotgun method

Q: When plasmids are used to produce a desired protein, the ________. A) plasmids multiply and produce the protein outside of the bacterium B) bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate C) desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium D) bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene

Q: Of these steps, which one occurs earliest in the process of producing recombinant DNA? A) Human DNA fragments are mixed with the cut plasmids. B) The same restriction enzyme is used to isolate the gene of interest and to cut the plasmid DNA. C) The recombinant plasmids are mixed with bacteria. D) Bacteria carrying recombinant plasmids are cloned.

Q: Of these steps, which occurs first in the production of a recombinant plasmid? A) cloning B) cutting DNA into fragments C) isolation of a plasmid from a bacterium D) reproduction of the engineered plasmid in bacteria

Q: Which of the following can act as a vector to introduce new genes into a cell? A) primers B) ligase C) restriction enzymes D) plasmids

Q: Transgenic animals are currently used ________. A) to produce potentially useful proteins B) as food C) as vectors for use in cloning human DNA D) all of the answer options are correct

Q: A vaccine works by ________. A) inhibiting bacterial reproduction B) stimulating the immune system to develop lasting defenses C) killing cells infected with a virus D) preventing translation of mRNA molecules that code for disease-causing proteins

Q: The world's first genetically engineered pharmaceutical product was ________. A) humulin B) HGH C) tPA D) EPO

Q: Which of the following best defines the term "transgenic organism"? A) an organism that is the first of its kind to bear a particular allele B) an organism in which a genetic defect has been corrected using recombinant DNA therapy C) an organism containing a gene from another species D) an organism containing genes from three or more species

Q: Which of the following is a genetically modified organism? A) an organism carrying a gene that was acquired by artificial means B) the first organism in which a particular mutation has appeared C) a cloned organism carrying two different alleles D) an organism that gestated in an artificial womb

Q: Which of the following is the best definition for recombinant DNA? A) DNA that results from bacterial conjugation B) DNA that includes pieces from two different sources C) an alternate form of DNA that is the product of a mutation D) DNA that carries a translocation

Q: What evidence led to Kirk Odom's freedom after being wrongly imprisoned for 30 years? A) an analysis of blood types from the crime scene B) an analysis of fingerprints from the crime scene C) accounts from witnesses D) an analysis of DNA from the crime scene

Q: Please read the paragraph below to answer the following questions.You conducted a series of experiments to test whether the expression of hexokinase, an important enzyme involved in glycolysis, varies under different conditions. In the first experiment, you measured the production of hexokinase mRNA in cells at three different temperatures: 37ºC, 25ºC, and 10ºC. Your results showed that the mRNA levels for hexokinase were 5 and 20 lower at 25ºC and 10ºC than at 37ºC, respectively. Based on these results, you are going to conduct further experiments to attempt to answer your research question.DNA microarrays can be used to determine relative levels of gene expression between samples. DNA microarrays are usually interpreted by color: green means higher mRNA levels, yellow means equal levels, and red means lower levels. If you ran the samples from the temperature experiment on a DNA microarray using the 25C experiment as a baseline, what results do you predict you would obtain?A) The samples from the 37ºC experiment would be green and the samples from the 10ºC would be red.B) The samples from the 37ºC experiment would be red and the samples from the 10ºC would be green.C) The samples from the 37ºC experiment would be green and the samples from the 10ºC would be yellow.D) The samples from the 37ºC experiment would be yellow and the samples from the 10ºC would be red.

Q: Please read the paragraph below to answer the following questions.You conducted a series of experiments to test whether the expression of hexokinase, an important enzyme involved in glycolysis, varies under different conditions. In the first experiment, you measured the production of hexokinase mRNA in cells at three different temperatures: 37ºC, 25ºC, and 10ºC. Your results showed that the mRNA levels for hexokinase were 5 and 20 lower at 25ºC and 10ºC than at 37ºC, respectively. Based on these results, you are going to conduct further experiments to attempt to answer your research question.What would be the best experiment to do next to determine if complete hexokinase gene expression is temperature dependent?A) Measure the amount of hexokinase mRNA in cells at different temperatures.B) Measure the rate of transcription of the hexokinase gene in cells at different temperatures.C) Measure the amount of mRNA that is broken down in cells at different temperatures.D) Measure the amount of hexokinase protein in cells at different temperatures.

Q: Please read the paragraph below to answer the following questions.You conducted a series of experiments to test whether the expression of hexokinase, an important enzyme involved in glycolysis, varies under different conditions. In the first experiment, you measured the production of hexokinase mRNA in cells at three different temperatures: 37ºC, 25ºC, and 10ºC. Your results showed that the mRNA levels for hexokinase were 5 and 20 lower at 25ºC and 10ºC than at 37ºC, respectively. Based on these results, you are going to conduct further experiments to attempt to answer your research question.What can you conclude from these results?A) Unpacking of the hexokinase gene occurs only at 37ºC.B) Transcription of the hexokinase gene occurs less frequently at lower temperatures.C) The levels of hexokinase protein are not affected by temperature.D) Translation of the hexokinase gene occurs more frequently at higher temperatures.

Q: Please read the paragraph below to answer the following questions. Jim has become particularly interested in the genetic basis of cancer and has spent considerable time reading published papers about oncogenes. He learned that as early as 1972 researchers suggested that mutations in proto-oncogenes caused by carcinogens can convert the proto-oncogenes to oncogenes. He asked you to answer a couple of questions about this because he did not have a sufficient biology background. Jim came across an advertisement for an herbal supplement that claimed to cure lung cancer by targeting precancerous cells in the lungs. If this claim were true, which of the following is a possible mechanism by which it may act? A) The supplement would increase mutation rates in proto-oncogenes. B) The supplement would inhibit the production of tumor suppressor proteins. C) The supplement would stimulate translation of growth factors D) The supplement would restrict the transcription of oncogenes.

Q: Please read the paragraph below to answer the following questions. Jim has become particularly interested in the genetic basis of cancer and has spent considerable time reading published papers about oncogenes. He learned that as early as 1972 researchers suggested that mutations in proto-oncogenes caused by carcinogens can convert the proto-oncogenes to oncogenes. He asked you to answer a couple of questions about this because he did not have a sufficient biology background. Jim learned that viruses can sometimes cause cancer and wants to know why. You tell him that ________. A) a human cell can acquire a tumor-suppressor gene from a virus B) a human cell can acquire a proto-oncogene from a virus C) a human cell can acquire an oncogene from a virus D) some viruses are passed from mother to child and cause "inherited" cancers

Q: Please read the paragraph below to answer the following questions. Jim has become particularly interested in the genetic basis of cancer and has spent considerable time reading published papers about oncogenes. He learned that as early as 1972 researchers suggested that mutations in proto-oncogenes caused by carcinogens can convert the proto-oncogenes to oncogenes. He asked you to answer a couple of questions about this because he did not have a sufficient biology background. Jim learned that some cancer cells produce more growth-stimulating proteins than others. What would you give him as a plausible explanation? A) Tumor suppressor genes may have been activated in these cells. B) Proto-oncogenes may have mutated to become oncogenes in these cells. C) Mutations in homeotic genes may be responsible. D) This may result from vitamin C and vitamin E deficiencies.

Q: Examine the figure below. In a typical colon cancer, the first step is ________. A) the inactivation of a tumor-suppressor gene B) the mutation of a tumor-suppressor gene, producing an oncogene C) the mutation of a proto-oncogene, producing an oncogene D) the conversion of an oncogene to a tumor-suppressor gene

Q: Consider the following figure, which outlines cloning by nuclear transplantation. Why does the clone NOT resemble the surrogate mother? A) The sperm came from a male donor, who would also pass some of his traits to the clone. B) The embryonic cells are adversely influenced by the surrogate. C) The DNA for the clone comes from the genetic donor, not the surrogate. D) The nuclear material from the egg would influence the appearance of the clone.

Q: The lac operon is shown in the accompanying figure. Answer the following question after reviewing the figure. The lac operon is usually in the ________ position and is activated by ________. A) on... the repressor B) off... lactose C) off... the repressor D) on... the promoter

Q: The figure below illustrates ________. A) transcription factors B) activators C) alternative RNA splicing D) protein activation

Q: Examine the figure below. The initiation of transcription requires that enhancers bind to ________. A) DNA B) the promoter C) transcription factors D) RNA polymerase

Q: Which of the following is NOT an example of how tumors evolve? A) Tumor cells can spread throughout the body. B) Tumor cells show genetic variability. C) Tumor cells grow uncontrollably. D) Tumor cells pass on mutations when they divide.

Q: Which of these lifestyle choices will increase cancer risk? A) jogging B) spending less time in the sun C) a diet low in plant fiber D) quitting smoking

Q: More people die of ________ cancer than of any other cancer. A) lung B) skin C) pancreatic D) breast

Q: ________ is(are) responsible for more cancers than any other carcinogen. A) Asbestos B) UV radiation C) Tobacco D) X-rays

Q: Which risk factor is associated with cancer of the colon and rectum? A) tobacco B) viruses C) UV radiation D) dietary fat

Q: If you were working for a pharmaceutical company trying to develop anticancer drugs, what biological process would be the best target to investigate? A) meiosis B) mitosis C) cellular respiration D) glycolysis

Q: When referring to cell division, oncogenes are most like ________ while tumor suppressor genes are most like ________. A) the brakes on a car the gas pedal on a car B) the gas pedal on a car the brakes on a car C) the steering wheel on a car the gas pedal on a car D) the brakes on a car the steering wheel on a car

Q: Data suggest that the normal version of BRCA1 functions as a(n) ________. A) oncogene B) tumor-suppressor gene C) proto-oncogene D) silencer

Q: Inheritance of certain genes increases the risk of getting certain cancers; thus, it can be said that ________. A) these cancers are inherited as a dominant trait B) mutations that occur in somatic cells can be passed from parent to offspring C) predisposition to these cancers is inherited D) lifestyle will have little impact on cancer risk for these individuals

Q: Many proto-oncogenes regulate ________. A) cell growth B) cell cloning C) cell division D) cell repair

Q: What name is given to a gene that causes cancer? A) repressor B) promoter C) homeotic gene D) oncogene

Q: What is a difference between embryonic and adult stem cells? A) The use of embryonic stem cells raises fewer ethical issues than the use of adult stem cells. B) Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated. C) It is easier to obtain embryonic stem cells. D) Adult stem cells are easier to grow in culture.

Q: Which of the following is NOT a possible use of reproductive cloning? A) the production of genetically identical mice and rats for experimentation B) the production of organs in large farm animals for transplant into humans C) restocking populations of extinct animals such as the wooly mammoth D) creating stocks of stem cells for human therapeutic use

Q: Why can mature plants be cloned to produce genetically identical copies? A) Mature plant cells contain only a fraction of the genes found in an adult plant. B) Plants have evolved over time to suit the need of human agriculture. C) Mature plant cells can develop into all the specialized cells of an adult plant. D) Scientists have engineered all plants to have this ability.

Q: How is it that the cells in different body tissues are able to perform different functions? A) The cells exhibit different patterns of gene expression. B) Different chromosomes have been inactivated in different cells. C) The cells contain different genes. D) The mutations that have accumulated in the cells of the different tissues control functions.

Q: Which of these techniques could tell you how gene expression differs between individuals with and without cystic fibrosis? A) therapeutic cloning B) DNA microarray C) reproductive cloning D) karyotyping

Q: Homeotic genes ________. A) have very different sequences in plant cells as compared to animal cells B) are an example of convergent evolution C) are evidence of the common ancestry of eukaryotic organisms D) regulate gene expression in both prokaryotic and eukaryotic cells

Q: Which of these is most likely to cause the development of a six-legged frog? A) mutation of homeotic genes B) binding of repressors to operons C) a mutation in DNA polymerase that affects all cells D) conversion of a proto-oncogene to an oncogene

Q: The "master control genes" that regulate other genes and determine what body parts will develop in which locations are called ________. A) enhancers B) homeotic genes C) oncogenes D) operons

Q: Cells communicate with one another via ________. A) cascades of gene activation B) the diffusion of RNA transcripts through adhesion junctions C) signal transduction pathways D) RNA splicing

Q: In a eukaryotic cell an abnormal protein is binding to the promoter for a gene. Which of the following processes will likely occur in this scenario? A) Transcription factors will bind to enhancers. B) Transcription factors will bind to the promoter. C) The gene will be expressed normally. D) RNA polymerase will bind to the promoter.

Q: What would enable a single RNA transcript to be translated into different polypeptides? A) The RNA transcript can be spliced more than one way. B) The coded polypeptide may be modified in more than one way. C) The length of the RNA transcript tail can vary. D) Two different genes can produce the same RNA transcript, which will then be translated differently.

Q: Which of these is a type of posttranscriptional regulation of gene expression? A) inactivation of tRNA B) alteration of DNA nucleotide sequences C) breakdown of proteins D) binding of transcription factors to enhancers

Q: Introns are ________. A) noncoding DNA sequences B) DNA sequences to which activators bind C) expressed DNA sequences D) the product of RNA splicing

Q: In eukaryotic cells, repressor proteins inhibit transcription by binding to ________. A) silencers B) enhancers C) promoters D) operons

Q: Which of these plays a role in the regulation of transcription in both prokaryotic and eukaryotic cells? A) RNA splicing B) attachment of RNA polymerase to the promoter C) transcription factors D) gene operons

Q: Male tortoiseshell cats ________. A) do not have an X chromosome B) have orange and black patches of fur that reflect the pattern of X chromosome inactivation C) are usually XYY individuals D) are likely to be exceedingly rare and very likely to be sterile since normal male cats are XY

Q: What is the first level of control of eukaryotic gene transcription? A) RNA splicing B) attachment of RNA polymerase to the promoter C) DNA packing and unpacking D) the binding and unbinding of transcription factors to enhancer sequences

Q: While examining a human cell that functions normally, you determine that it has 45 functional chromosomes and one chromosome that is almost completely inactive. You immediately decide that it is very likely that this cell ________. A) came from a normal human female B) is lacking a chromosome C) is a gamete D) will become cancerous if one or two more genes are mutated

Q: What would you assume if you found RNA transcripts of lactose-utilizing genes within E. coli? A) Lactose has bound to the lac operon activator. B) Lactose is present in the cell. C) The lac operon activator protein is present in the cell. D) The lac operon repressor protein is absent in the cell.

Q: Repressors act by blocking the binding of ________ to the operator. A) promoters B) DNA polymerase C) the operon D) RNA polymerase

Q: Which of the following turns off transcription by binding to the operator? A) RNA polymerase B) repressor C) promoter D) lactose

Q: In an operon, the ________ acts as an on/off switch. A) operator B) promoter C) activator D) repressor

Q: In prokaryotes, the production of a single RNA transcript for a group of related genes is under the control of ________. A) an operon B) enhancers C) a signal transduction pathway D) transcription factors

Q: Bacterial RNA polymerase binds to the ________. A) operator B) proto-oncogene C) regulatory gene D) promoter

Q: In bacteria, what name is given to a cluster of genes with related functions, along with their DNA control sequences? A) operon B) operator C) promoter D) exon

Q: The process by which genotype becomes expressed as phenotype is ________. A) gene regulation B) transcription C) gene expression D) translation

Q: What happened when researchers added BPDE, a component of tobacco smoke, to human lung cells in a laboratory experiment? A) The cells behaved normally. B) The cells shrank in size. C) The cells developed mutations in their p53 genes. D) The cells required less energy to grow.

Q: Thymine and cytosine differ from adenine and guanine in that ________. A) thymine and cytosine are single-ring structures, whereas adenine and guanine are double-ring structures B) thymine and cytosine are only found in DNA, whereas adenine and guanine are found in both DNA and RNA C) thymine and cytosine are only found in DNA, whereas adenine and guanine are only found in RNA D) thymine and cytosine are larger nitrogenous bases

Q: The backbone of DNA consists of ________. A) nitrogenous bases B) a repeating sugar-nucleotide-sugar-nucleotide pattern C) a repeating sugar-phosphate-sugar-phosphate pattern D) paired nucleotides

Q: DNA and RNA are polymers composed of ________ monomers. A) nucleotide B) carbohydrate C) fatty acid D) amino acid

Q: What was a surprising feature about the deadly nature of the 2009 H1N1 influenza virus? A) H1N1 affected the elderly. B) H1N1 affected healthy young people. C) H1N1 affected birds. D) H1N1 affected pigs.

Q: Please read the following scenario to answer the following questions. While working with cultured mouse cells, a researcher unknowingly treated the cells with a mutagen that causes the deletion or insertion of individual nucleotides in DNA. Subsequently, the researcher isolated and cultured a single cell from this group and noticed that the progeny of this cell were not producing a certain protein and that this affected their survival. The researcher isolated a different single cell and determined that it was producing a certain protein. However, the protein was much shorter than it should have been. What kind of mutation likely occurred in this protein? A) one that introduced a silent mutation B) one that substituted amino acids C) one that introduced a premature stop codon D) one that deleted an entire amino acid