Accounting
Anthropology
Archaeology
Art History
Banking
Biology & Life Science
Business
Business Communication
Business Development
Business Ethics
Business Law
Chemistry
Communication
Computer Science
Counseling
Criminal Law
Curriculum & Instruction
Design
Earth Science
Economic
Education
Engineering
Finance
History & Theory
Humanities
Human Resource
International Business
Investments & Securities
Journalism
Law
Management
Marketing
Medicine
Medicine & Health Science
Nursing
Philosophy
Physic
Psychology
Real Estate
Science
Social Science
Sociology
Special Education
Speech
Visual Arts
Question
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule?GTAAGCTTCGACAAGCTTGCTGA
A) 0 times
B) 1 time
C) 2 times
D) 3 times
Answer
This answer is hidden. It contains 1 characters.
Related questions
Q:
In most developing countries, ________.
A) birth rates equal death rates, so the population is fairly stable
B) birth rates are lower than death rates, so the population is declining
C) birth rates are lower than death rates, so the population is growing rapidly
D) birth rates are much higher than death rates, so the population is growing rapidly
Q:
Throughout most of human history, human population size ________.
A) was at carrying capacity
B) grew very slowly
C) showed boom-and-bust cycles
D) skyrocketed
Q:
Most crop pests ________.
A) have an opportunistic life history
B) have an equilibrial life history
C) exhibit type I survivorship
D) consist of long-lived individuals
Q:
If there are 500 oak trees in a forest covering 50 square kilometers, then the population density is ________.
A) 5 trees per square kilometer
B) 10 trees per square kilometer
C) 50 trees per square kilometer
D) 100 trees per square kilometer
Q:
Opportunistic species typically ________.
A) are very long-living
B) have a large number of offspring
C) reach sexual maturity slowly
D) exhibit a Type I survivorship curve
Q:
Please read the following scenario to answer the following questions.
In May 2014, the European Union (EU) published a report of population structure and aging data that described growing trends of low birth rates and longer life expectancies in the EU. In their report, the EU described that, due to these trends, some EU member states are beginning to demonstrate a population structure with many much-older individuals.
Why might this changing population structure be a concern for EU leaders?
A) Eventually greater resources will be needed to support a much larger and older generation, and this burden will fall on an increasingly smaller workforce.
B) Eventually the EU population will exhibit a Type III survivorship curve.
C) Eventually intraspecific competition for resources amongst the older members of the population will lead to a decrease in food and water availability.
D) Eventually individuals of reproductive age will face a boom-and-bust population cycle.
Q:
Please read the following scenario to answer the following questions.
CO2 is not the only greenhouse gas that impacts global climate change. Other greenhouse gases (GHGs) may be equally or more effective than CO2 at trapping heat on Earth. Climate scientists determine how much a GHG may impact global warming based on two factors: the efficiency with which a GHG absorbs energy (i.e. traps heat on Earth) and the length of time (in years) that the gas remains in the atmosphere. A unit of measurement called the Global Warming Potential (GWP) is used to describe how much energy a GHG absorbs over a specific period of time (100 years is a standard time frame). All GWP values of GHGs are compared to the GWP of CO2, which is given a value of 1.
has a GWP over 20 times higher than CO2. However, CH4 emitted today lasts for only about a decade in the atmosphere, while the GWP of CO2 can last for thousands of years. What is a possible reason that CH4 can have such a high GWP as compared to CO2?
A) The 100-year time frame is too short of a time frame to compare CH4 and CO2.
B) CH4 absorbs more energy than CO2.
C) CH4 is less efficient at trapping heat on Earth.
D) CH4 is not a proven greenhouse gas.
Q:
Examine the figure below. Phytoplankton live in the ________. A) photic zone and aphotic zone
B) aphotic zone
C) benthic realm
D) photic zone
Q:
Which of the following is NOT a result of global warming?
A) changes in the breeding seasons of some species
B) increased forest clearing for agricultural purposes
C) melting permafrost
D) shifts in the ranges of some species
Q:
Most of the temperate grassland in North America has been converted to ________.
A) cities
B) farmland
C) national parks
D) small neighborhoods
Q:
In what part of the ocean are phytoplankton found?
A) pelagic realm
B) intertidal zone
C) benthic realm
D) aphotic zone
Q:
What term applies to the physical and physiological changes experienced by astronauts who spend months in space?
A) acclimation
B) adaptation
C) camouflaging
D) flagging
Q:
What level of ecology is concerned with both the biotic and abiotic aspects of an environment?
A) community
B) organism
C) ecosystem
D) population
Q:
What is a population?
A) a group of organisms living in a particular geographic area
B) a group of organisms of the same species living in a particular geographic area
C) a community as well as all the abiotic factors in a particular geographic area
D) all of the organisms of a species existing at a particular time
Q:
What level of ecology is concerned with groups of individuals of the same species?
A) community
B) organism
C) ecosystem
D) population
Q:
If you study how two species of finches compete for food, you are trying to answer a question about ________.
A) community ecology
B) population ecology
C) organismal ecology
D) ecosystems ecology
Q:
According to this evolutionary tree, approximately how many years ago did humans and orangutans share a common ancestor?
A) 1 million years ago
B) 7 million years ago
C) 12 million years ago
D) 20 million years ago
Q:
Insects, such as the grasshopper shown below, have ________. A) eight legs
B) a two-part body: head and abdomen
C) a three-part body: head, thorax, and abdomen
D) no wings
Q:
The process of biological evolution often allows humans to survive consistent environmental stresses that occur across multiple generations. As humans colonized Earth's diverse environments, they encountered hot, dry areas and decided to settle. What trait likely offered an advantage in this environment?
A) the ability to produce sweat to cool their bodies
B) the ability to shiver to create body heat
C) the ability to squint eyes to block out bright light
D) the ability to dig deep holes to find groundwater
Q:
At a natural history museum, you see a skeleton with the following characteristics: four long, slender finger bones and a smaller opposable thumb bone, and larger feet with long toes. In what type of environment would you expect this organism to have lived?
A) one that lacks vegetation
B) one that is very cold
C) one that is very dry
D) one that is heavily forested
Q:
________ are the mammalian group that lays eggs.
A) Eutherians
B) Tunicates
C) Monotremes
D) Marsupials
Q:
A characteristic that is shared by snakes and birds is ________.
A) being ectothermic
B) the presence of only a single ovary in females
C) the amniotic egg
D) being endothermic
Q:
Among vertebrates, the unique feature of lampreys and hagfish is the ________.
A) presence of a cartilaginous skeleton
B) absence of a backbone
C) absence of jaws
D) absence of a postanal tail
Q:
You discover an organism that has scaly skin and is aquatic but returns to the land to reproduce. What else would you expect to find in this organism?
A) asexual reproduction
B) amniotic egg
C) a water vascular system
D) radial symmetry
Q:
How do sponges differ from all other animals?
A) Sponges exhibit radial symmetry.
B) Sponges are autotrophs.
C) Sponges lack a true body cavity.
D) Sponges lack true tissues.
Q:
Humans are chordates. Which animal group is most closely related to chordates?
A) molluscs
B) echinoderms
C) annelids
D) arthropods
Q:
J. R. R. Tolkien is a famous author who wrote, among others, several books about the adventures of a community of a humanoid (meaning resembling a human) race. The individuals of this race are described by Tolkien as being "between 2 and 4 feet (0.61-1.22 m) tall, the average height being 3 feet 6 inches (1.07 m) a fairly human figure." This general description characterizes the humanoids mostly closely resembling ________.
A) Homo sapiens
B) Homo floresiensis
C) mandrills
D) lemurs
Q:
Read the following scenario to answer the following questions.
People utilize plants to meet many everyday needs, including food, fiber, and building materials. However, not many of the over 300,000 known species of plants are used by people. One species with a lot of future promise is the jatropha tree. This species is native to Central America and is now found throughout the tropics. Many people believe the jatropha could help alleviate poverty in many areas of the world, as the seeds produce an oil that can be used for cooking, lighting, or generating electricity. This oil can also be mixed with diesel fuel or petrol to produce a biofuel. Mature trees produce between 5 and 15 kg of seeds per year and can live more than 30 years. However, critics argue that planting the jatropha tree will take land needed for food production, which will in turn harm the poor.
What would NOT be an advantage of using oil from jatropha seeds?
A) The oil is considered a renewable resource.
B) The oil can be used for generating electricity.
C) The oil can be used as a biofuel.
D) Growing jatropha tress to produce oil may lower food production.
Q:
What important role do fungi play in many ecosystems?
A) They decompose organic material.
B) They pollinate plants.
C) They disperse the fruits of angiosperms.
D) They perform photosynthesis.
Q:
Like plants, fungi have ________; however, in plants they are composed of ________, whereas in fungi they are composed of ________.
A) cell walls... cellulose... chitin
B) cell walls... cellulose... peptidoglycan
C) cell membranes... phospholipids... chitin
D) cell walls... phospholipids... cellulose